BBa_K638402 1 BBa_K638402 TorA tag variant 2011-09-18T11:00:00Z 2015-05-08T01:12:57Z De novo synthesis based on a sequence from the literature. We found a TorA sequence which had been successfully used to export GFP to the periplasm of E.coli. The sequence was originally taken from this paper: Export of active green fluorescent protein to the periplasm by the twin-arginine translocase (Tat) pathway in Escherichia coli Joanna D. Thomas1, Richard A. Daniel2, Jeff Errington2, Colin Robinson1,* The sequence was added into our constructs as part of a gibson assembly primer. false false _814_ 0 9698 9 Not in stock false This part was checked for illeagal restriction sites and none were found. false Matthew Jones BBa_K638402_sequence 1 atggcgaacaacgacttatttcaggcttctcggcgtcgctttctggcgcagctgggcggattaacggtggcgggtatgttgggcccgtcgctgttgactcctcgcagagcgacggcagcacaagccgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z