BBa_K648012 1 BBa_K648012 LacZa wtih Standard 25 Prefix/Suffix 2011-07-03T11:00:00Z 2015-05-08T01:12:59Z This part was amplified out of registry stock of LacZa in order to include the standard 25 prefix/suffix This is the lacZa subunit used to complement cells for blue/white screening. It has been cloned into a vector including the prefix/suffix required for standard 25 assembly for fusion proteins. false false _825_ 0 9871 9 Not in stock false This part contains the AgeI and NgoMIV sites as part of it's prefix/suffix that allows it to be used in standard 25 assembly. It was synthesized through PCR oligo synthesis methods using the following primers: Forward TATTGAATTCGCGGCCGCTTCTAGATGGCCGGCACCATGATTACGGATTCAC (57.74 oC) Reverse ATAACTGCAGCGGCCGCTACTAGTATTAACCGGTTCACTCCAGCCAGC (55.05 oC) false Jim Rose annotation2122826 1 protein range2122826 1 1 228 BBa_K648012_sequence 1 accatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z