BBa_K654096 1 BBa_K654096 E. coli Reference Promoter (fusion of Anderson 0.51 and 1.00 promoters) 2011-09-25T11:00:00Z 2015-05-08T01:13:02Z Primer Annealing This promoter was created from a combination of the 0.51 Anderson Reference Promoter (-35 box) and the 1.00 Anderson Reference Promoter (-10 box). false false _831_ 0 6788 9 In stock false mistake in primer design caused "fusion" part appearance, kept as it is a unique new promoter false Cody Tramp annotation2142557 1 Anderson 0.51/1.00 fusion promoter range2142557 1 1 37 annotation2142554 1 -35 box range2142554 1 1 6 annotation2142556 1 -10 box range2142556 1 25 30 BBa_K654096_sequence 1 gctgacagctagctcagtcctaggtacagtgctagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z