BBa_K678025 1 MTS Mitochondrial targeting sequence for Aspergillus nidulans 2011-09-03T11:00:00Z 2015-05-08T01:13:04Z Aspergillus nidulans genomic DNA (AN6279) Mitochondrial targeting sequence (MTS) for Aspergillus nidulans. A MTS is usually required for the entry of proteins and intermediary metabolites into mitochondria. The MTS is a DNA fragment encoding the N-terminal 60 amino acids of the AcuJ. false false _882_ 0 8341 9 It's complicated false Compatible with the Plug'n'Play assembly standard. This MTS should be placed at the N-terminal of the gene of interest. false DTU-Denmark-2 annotation2127379 1 Linker 2 range2127379 1 1 8 annotation2125850 1 MTS range2125850 1 9 188 BBa_K678025_sequence 1 agtgcgatatgtttacagcggcagctcggagccgtttctcttctactcttgctcgcccccgtctcgctccgacaaattcccttctcgctagatcttcagtggtaggatacttcttttctttttaccctgcagatatcggagtctggttaacagattatcaggcttcaacaatggctccgcggcgcaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z