BBa_K726004 1 BBa_K726004 RelB 2012-08-09T11:00:00Z 2015-05-08T01:13:05Z The part is from the e. coli genome. part of a toxin-antitoxin system. false false _972_ 0 10304 9 Not in stock false none. false Sami Chu annotation2179474 1 relB range2179474 1 1 240 BBa_K726004_sequence 1 atgggtagcattaacctgcgtattgacgatgaacttaaagcgcgttcttacgccgcgcttgaaaaaatgggtgtaactccttctgaagcgcttcgtctcatgctcgagtatatcgctgacaatgaacgcttgccgttcaaacagacactcctgagtgatgaagatgctgaacttgtggagatagtgaaagaacggcttcgtaatcctaagccagtacgtgtgacgctggatgaactctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z