BBa_K726003 1 BBa_K726003 T7 promoter + lac operator + His tag 2012-08-08T11:00:00Z 2015-05-08T01:13:05Z The sequence is from pCDFDuet from Novagen. T7 promoter is good for protein expression in <i>e. coli</i>. Requires the T7 RNA polymerase. Also contains a RBS, and a His tag for protein purification. Insert your protein of interest behind this. false false _972_ 0 10304 9 Not in stock false none. false Sami Chu annotation2179384 1 T7 promoter range2179384 1 1 17 annotation2179385 1 His tag range2179385 1 100 117 annotation2179473 1 lac operator range2179473 1 22 42 BBa_K726013 1 BBa_K726013 YoeB 2012-10-01T11:00:00Z 2015-05-08T01:13:05Z This part was obtained from E. coli gDNA YoeB, Toxic component of a toxin-antitoxin (TA) module. The antitoxin is YefM. false false _972_ 0 10295 9 Not in stock false n/a false Veronica Zepeda BBa_K726014 1 BBa_K726014 T7Prom+HisTag+YoeB 2012-10-01T11:00:00Z 2015-05-08T01:13:05Z This part is from E. coli gDNA and the pcdfduet vector from Novagen. This is a composite part which contains a T7 promoter, RBS, lac operator, 6x his tag, and YoeB. YoeB is the toxin in the YefM/YoeB toxin-antitoxin pair from E. coli. false false _972_ 0 10295 9 It's complicated false n/a false Kendall Kearns component2206595 1 BBa_K726003 component2206596 1 BBa_K726013 annotation2206596 1 BBa_K726013 range2206596 1 138 392 annotation2206595 1 BBa_K726003 range2206595 1 1 129 BBa_K726013_sequence 1 gtgaaactaatctggtctgaggaatcatgggacgattatctgtactggcaggaaacagataagcgaattgttaaaaagatcaatgaacttatcaaagatacccgcagaacgccatttgaaggtaaggggaagccagaacccctgaaacataatttgtcaggtttctggtcccgacgcattacagaggagcaccgtctggtatacgcggttaccgacgattcactgctcattgcagcatgtcgttatcattattga BBa_K726014_sequence 1 taatacgactcactataggggaattgtgagcggataacaattcccctgtagaaataattttgtttaactttaataaggagatataccatgggcagcagccatcaccatcatcaccacagccaggatccgtactagaggtgaaactaatctggtctgaggaatcatgggacgattatctgtactggcaggaaacagataagcgaattgttaaaaagatcaatgaacttatcaaagatacccgcagaacgccatttgaaggtaaggggaagccagaacccctgaaacataatttgtcaggtttctggtcccgacgcattacagaggagcaccgtctggtatacgcggttaccgacgattcactgctcattgcagcatgtcgttatcattattga BBa_K726003_sequence 1 taatacgactcactataggggaattgtgagcggataacaattcccctgtagaaataattttgtttaactttaataaggagatataccatgggcagcagccatcaccatcatcaccacagccaggatccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z