BBa_K736000 1 BBa_K736000 Constitutive Promoter (J23100) with MLC (glucose-regulated) binding site 2012-06-15T11:00:00Z 2015-05-08T01:13:07Z PCR was done using DNA primers designed for J23100, adding the MLC binding sequence to the 3' end. A modified VF2 was used for the 5' antisense. This part is designed to regulate transcription of downstream genes according to glucose concentration. In the absence of glucose in Escherichia coli cells, MLC is bound to DNA; this prevents transcription. When glucose enters the cell, a phosphoryl group from an endogenous protein (EIIBC-gluc) is transferred to the glucose. When EIIBC-gluc is unphosphorylated, it recruits the MLC protein; that is, the MLC becomes unbound from the DNA, which allows transcription to occur. false false _985_ 0 13677 9 It's complicated false The EIIBC-gluc is responsible for proliferating the glucose signal to allow for transcription to occur. false Lethbridge iGEM High School Team BBa_K736000_sequence 1 ttgacggctagctcagtcctaggtacagtgctagcattaattacgaagcgcaaaaaaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z