BBa_K737023 1 BBa_K737023 Promoter that can be induced by phosphate. 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z No Promoter that can be induced by phosphate. The downstream promoter has a single copy of the pho box, the consensus sequence shared by the pho promoters. These pho boxes are the binding sites of its corresponding response regulators phoB. Two molecules of phoB protein form a complex that could bind to the pho boxes and up-regulate the downstream expression. false false _986_ 0 14291 9 It's complicated false No false Minghao Gong BBa_K737023_sequence 1 acggaaatcaataacctgaagatatgtgcgacgagcttttcataaatctgtcataaatctgacgcataatgacgtcgcattaatgatcgcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z