BBa_K737026 1 BBa_K737026 Promoter that can be induced by phosphate and carbon starvation. 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z No The downstream promoter has multiple copies of the pho box, the consensus sequence shared by the pho promoters. These pho boxes are the binding sites of its corresponding response regulators phoB. Two molecules of phoB protein form a complex that could bind to the pho boxes and up-regulate the downstream expression. false false _986_ 0 14291 9 Not in stock false No false Minghao Gong BBa_K737026_sequence 1 atgaaacgatgagcaatctgtagagtttgattcagaccttctatattttcccgcttatccgtgccccatctcccattttccctcacccacgccgtcaccgccttgtcatctttctgacaccttactatcttacaaatgtaacaaaaaagttatttttctgtaattcgagcatgtcatgttaccccgcgagcataaaacgcgtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z