BBa_K747000 1 BBa_K747000 TAL-Protein_AA1_DiRepeat 2012-09-21T11:00:00Z 2015-05-08T01:13:09Z This Part was synthesized and flanked with BsmB1-restriction sites Released HQ 2013 This Part specifies the DNA binding affinity of the 2. and 3. base pair of a Transactivator-like (TAL) protein. The TAL-Protein binds a specific fourteen base pair DNA sequence. The 2. and 3. base pair of this part is specified by adenine-adenine. false false _998_ 0 13224 9 In stock false This part can only be used within the TAL-effector-toolkit designed by the IGEM2012 Team Freiburg. false Lucas Schneider annotation2195665 1 AA 1 range2195665 1 12 209 BBa_K747000_sequence 1 cgtctcatgaccccggaacaggtggtggccatcgcctccaacattggtggtaagcaagccctcgaaactgtgcagcggctgcttccagtcttgtgccaggctcacggcctgacaccggagcaggtggttgcaatcgcgtctaatatcggcggcaaacaggcattggagaccgtgcagcgcttgcttccagtgctgtgtcaggcccacgggctctgagacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z