BBa_K766005 1 BBa_K766005 T7 promoter-Hig tag-LuxI wihout LVA tag 2012-09-23T11:00:00Z 2015-05-08T01:13:14Z We clone this gene from our lab's plamid which is commonly used We build this part to work as the signal sender in our project. T7 promoter is a high-efficient promoter which can bind with T7 polymerase and start the transcription. Besides, we add the lac operator between T7 promoter and CDS. If you use this part in a lacI-coding plasmid like pet15b, the expression of gene will be repressed. However, IPTG can be used to activate the expression. The expression of this part can be well-controled. His tag is on the N-terminal, which consists of six histidine amino acid. We can use Ni-column to purify the protein. Besides, you can use Hig-tag antibody to detect the protein in western blot. This design makes the detection of luxI gene become very easy. On the 5' end of sequence, we add Bgl2 cutting site. On the 5' end of luxI gene, we add Nde1 cuting site. On the 3'end of LuxI gene, we add Xho1 and BamH1 cutting site. All of this design is for the convenience of further use. This part can be only used in the E.coli strains that can express T7 polymerase like BL21(DE3). false false _1018_ 0 8494 9 Not in stock true We want to build a signal sender which is easy detected and controled. false Yu Zhao annotation2194873 1 T7 promoter range2194873 1 20 37 annotation2194876 1 LuxI without LVA tag range2194876 1 177 746 annotation2194875 1 Poly his tag range2194875 1 120 137 annotation2194874 1 Lac operator range2194874 1 39 65 annotation2194877 1 T7 terminator range2194877 1 819 866 BBa_K766005_sequence 1 agatctcgatcccgcgaaattaatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgtttaactttaagaaggagatataccatgggcagcagccatcatcatcatcatcacagcagcggcctggtgccgcgcggcagccatatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaattaactcgaggatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z