BBa_J23104 1 BBa_J23104 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters replace later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_K777102 1 BBa_K777102 flhDC operon under the control of constitutive promoter J23104 2012-09-18T11:00:00Z 2015-05-08T01:13:16Z * The part was amplified from genomic DNA of E. coli str. K-12 substr. DH10B, complete genome (CP000948.1). * J23100 information was taken from the partsregistry and physical DNA from the 2012 distribution kit. The flhDC operon is the master regulator of motility and chemotaxis in E. coli. FlhDC forms heterotetramers and activates class II operons in concert with sigma factor 70. Among the gene products of class II operons are several components of the flagellum and the alternative sigma factor FliA which is essential for the transcription of class III genes. Here we used a set of 8 constitutive Anderson-promoters from the 2006 Berkeley group to test how different levels of constitutive flhDC expression affect the motility of E. coli. false false _1029_ 0 12106 9 It's complicated false * The PstI restriction site in the flhDC sequence was mutated to CTGCGG using the reverse primer * flhDC was amplified from genomic DNA of E. coli DH10B via PCR using the following primers: ** Fwd: 5'-actgaattcgcggccgcttctagatgcatacctccgagttgctg-3' ** Rev: 5'-tcctgcagcggccgctactagttactgcccgggatggcggttgacataagcCgcaggcaaagctgccaacag-3'<br>(the capitalized "C" induces the mutation for removal of the PstI site) false Team Goettingen component2187014 1 BBa_K777100 component2187006 1 BBa_J23104 annotation2187014 1 BBa_K777100 range2187014 1 42 910 annotation2187006 1 BBa_J23104 range2187006 1 1 35 BBa_K777100 1 BBa_K777100 flhDC 2012-09-14T11:00:00Z 2015-05-08T01:13:16Z The part was amplified from genomic DNA of E. coli str. K-12 substr. DH10B, complete genome (CP000948.1). The flhDC operon is the master regulator of motility and chemotaxis in E. coli. FlhDC forms heterotetramers and activates class II operons in concert with sigma factor 70. Among the gene products of class II operons are several components of the flagellum and the alternative sigma factor FliA which is essential for the transcription of class III genes. false false _1029_ 0 12106 9 In stock false The PstI restriction site was mutated to CTGCGG using the reverse primer. false Team Goettingen annotation2183218 1 TGA stop codon range2183218 1 349 351 annotation2183224 1 TAA stop codon range2183224 1 867 869 annotation2183216 1 ATG start codon range2183216 1 1 3 annotation2183217 1 FlhD coding region range2183217 1 1 351 annotation2183220 1 ATG start codon range2183220 1 354 356 annotation2183225 1 PstI site removed range2183225 1 839 839 annotation2183222 1 FlhC coding region range2183222 1 354 869 BBa_K777100_sequence 1 atgcatacctccgagttgctgaaacacatttatgacatcaacttgtcatatttactacttgcacagcgtttgattgttcaggacaaagcgtccgctatgtttcgtctcggcataaatgaagaaatggcgacaacgttagcggcactgactcttccgcaaatggttaagctggcagaaaccaatcaactggtttgtcacttccgttttgacagccaccagacgattactcagttgacgcaagattcccgcgttgacgatctccagcaaattcataccggcatcatgctctcaacacgcttgctgaatgatgttaatcagcctgaagaagcgctgcgcaagaaaagggcctgatcatgagtgaaaaaagcattgttcaggaagcgcgggatattcagctggcaatggaattgatcaccctgggcgctcgtttgcagatgctggaaagcgaaacacagttaagtcgcggacgcctgataaaactttataaagaactgcgcggaagcccaccgccgaaaggcatgctgccattctcaaccgactggtttatgacctgggaacaaaacgttcatgcttcgatgttctgtaatgcatggcagtttttactgaaaaccggtttgtgtaatggcgtcgatgcggtgatcaaagcctaccgtttataccttgaacagtgcccacaagcagaagaaggaccactgctggcattaacccgtgcctggacattggtgcggtttgttgaaagtggattactgcaactttccagctgcaactttccagctgcaactgctgcggcggcaattttattacccacgctcaccagcctgttggcagctttgcctgcggcttatgtcaaccgccatcccgggcagtaa BBa_K777102_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagatgcatacctccgagttgctgaaacacatttatgacatcaacttgtcatatttactacttgcacagcgtttgattgttcaggacaaagcgtccgctatgtttcgtctcggcataaatgaagaaatggcgacaacgttagcggcactgactcttccgcaaatggttaagctggcagaaaccaatcaactggtttgtcacttccgttttgacagccaccagacgattactcagttgacgcaagattcccgcgttgacgatctccagcaaattcataccggcatcatgctctcaacacgcttgctgaatgatgttaatcagcctgaagaagcgctgcgcaagaaaagggcctgatcatgagtgaaaaaagcattgttcaggaagcgcgggatattcagctggcaatggaattgatcaccctgggcgctcgtttgcagatgctggaaagcgaaacacagttaagtcgcggacgcctgataaaactttataaagaactgcgcggaagcccaccgccgaaaggcatgctgccattctcaaccgactggtttatgacctgggaacaaaacgttcatgcttcgatgttctgtaatgcatggcagtttttactgaaaaccggtttgtgtaatggcgtcgatgcggtgatcaaagcctaccgtttataccttgaacagtgcccacaagcagaagaaggaccactgctggcattaacccgtgcctggacattggtgcggtttgttgaaagtggattactgcaactttccagctgcaactttccagctgcaactgctgcggcggcaattttattacccacgctcaccagcctgttggcagctttgcctgcggcttatgtcaaccgccatcccgggcagtaa BBa_J23104_sequence 1 ttgacagctagctcagtcctaggtattgtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z