BBa_K779504 1 BBa_K779504 Long scrambled input strand MammoBlock 2012-09-28T11:00:00Z 2015-05-08T01:13:18Z De novo design. Released HQ 2013 Long non-matching (scrambled) input strand to act as a negative control to the reporter formed by parts [[Part:BBa K779500]] and [[Part:BBa K779502]] or [[Part:BBa K779501]] and [[Part:BBa K779502]]. Modifications: 5' IRD800 fluorophore, 3' phosphate. IDT DNA oligo order: /5IRD800/mAmC mUmAmA mCmCmU mAmAmC mUmAmC mAmAmC mAmAmC mAmCmU mAmUmC mCmA/3Phos/ false false _1033_ 0 12684 9 In stock false In the domain, uses the same nucleotides as the Sa, but is scrambled so that the Sa and Sc domains are orthogonal. See more details at the MIT iGEM wiki: http://2012.igem.org/Team:MIT false Kristjan Eerik Kaseniit annotation2204257 1 Domain Sc range2204257 1 1 20 annotation2204258 1 Toehold range2204258 1 21 28 BBa_K779504_sequence 1 actaacctaactacaacaacactatcca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z