BBa_K783082 1 BBa_K783082 pMmoR, a sigma 54-regulated promoter MoClo format 2012-10-02T11:00:00Z 2015-05-08T01:13:21Z Methylosinus trichosporium OB3b genomic DNA pMmoR is a promoter isolated from Methylosinus trichosporium OB3b and is in the sigma-54 regulatory family of promoters. The gene mmoR from Methylosinus trichosporium OB3b induces pMmoR and copper represses that activity. This has two MoClo fusion sites flanking the part. false false _1038_ 0 8248 9 It's complicated false We had to design the MoClo fusion sites. false Traci Haddock annotation2211544 1 MoClo fusion site A range2211544 1 1 4 annotation2211545 1 MoClo fusion site B range2211545 1 399 403 BBa_K783082_sequence 1 agcagcgaatggcgaaagaatgaaagcgctgcggcgatgcttcgccgcagcgtttttttatgcgcggatgcgcccgtgatttcatcgaatgcagtcatcatcacgatacgggagtatggttctttgacatgtgtatcgcgcatcgccatagcacgatcatttttacgcgtcgcacgtagttgcgaatgcgacgaatcccaacaaataccgatgaaatctattatccgcagcgagtggcacaggccttgccaaataagaagcgtcgacgcttccgcgcagatgcgcaaggacgagagacgtttcgaaaacccgaggtttggaaagcggcgacgcggttcggatgatcgacgcgcgcaatgagcgcgagcacgacggtccgaaacaaaagaaaactctgtctact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z