BBa_K785002 1 BBa_K785002 T7 terminator 2012-09-21T11:00:00Z 2015-05-08T01:13:22Z Sequence is from the PET28a plasmid.DNA is synthesized by Shanghai Sangon company. Released HQ 2013 This terminator is the replacement of failed part BBa_B0012. false false _1040_ 0 11000 9 In stock false With the fail of the T7 terminator in the Parts Registry's Terminators Catalog, we synthesized this part. false Zining Hou BBa_K785002_sequence 1 ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z