BBa_K792006 1 TrpZipper2 Tryptophan rich peptide (TrpZipper2) 2012-09-24T11:00:00Z 2015-05-08T01:13:23Z Tryptophan zippers: Stable, monomeric beta-hairpins [Cochran 2001] '''TrpZipper''' is a small peptide that folds into a beta-hairpin secondary structure. The indole rings of the Trp form a hydrophobic core. The protein is water soluble and monomer. false false _1047_ 0 11811 9 Not in stock false Sequence obtained by retro-translation. Codon and mRNA-secondary structure optimized for yeast. false Manuel Gim??nez annotation2196616 1 stop range2196616 1 43 48 annotation2197860 1 cds range2197860 1 7 42 annotation2196458 1 HindIII restriction site range2196458 1 1 6 BBa_K792006_sequence 1 aagctttcctggacctgggaaaacggtaaatggacttggaagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z