BBa_K792003 1 TAT-trojan Import enhancer - HIV TAT penetratin (trojan peptide) 2012-09-23T11:00:00Z 2015-05-08T01:13:23Z HIV TAT penetratin Trojan peptides are short sequences that penetrate through the plasma membrane inside the cell without the need of any receptor or endocitosis process [Derossi 1998]. They can be used to increase the efficiency with which a protein enters a cell. This part is the penetratin from the HIV TAT protein, and has to be used just before the coding sequence of the peptide that you want to be ''import enhanced''. false false _1047_ 0 11811 9 Not in stock true Sequence obtained by retro-translation false Manuel Gim??nez annotation2197881 1 Trojan peptide range2197881 1 7 39 annotation2196325 1 HindIII restriction site range2196325 1 1 6 BBa_K792009 1 BBa_K792009 Yeast exportable His-rich peptide w/enhanced import (1) 2012-09-24T11:00:00Z 2015-05-08T01:13:23Z Composite part. Released HQ 2013 This composite device produces and exports a Histidine rich peptide, that is import enhanced (thanks to a trojan peptide). The high level structure of the device is: * Kozak consensus sequence for initiation of translation * Signal peptide that targets the product of the gene for secretion * Trojan peptide, to increase internalization in target cell * Payload: this is the exported amino acid rich domain of the protein false false _1047_ 0 11811 9 In stock false Composite part false Manuel Gim??nez component2196484 1 BBa_K792003 component2196482 1 BBa_K792002 component2196481 1 BBa_K792001 component2196486 1 BBa_K792005 annotation2196481 1 BBa_K792001 range2196481 1 1 21 annotation2196486 1 BBa_K792005 range2196486 1 115 162 annotation2196482 1 BBa_K792002 range2196482 1 22 75 annotation2196484 1 BBa_K792003 range2196484 1 76 114 BBa_K792005 1 HisTag Histidine rich peptide (His Tag) 2012-09-24T11:00:00Z 2015-05-08T01:13:23Z Clontech???s His-tag. Stable and soluble Histidine rich peptide. false false _1047_ 0 11811 9 Not in stock false Retro-translated and optimized (codons and mRNA seconday structure) for yeast. false Manuel Gim??nez annotation2197882 1 His tag range2197882 1 7 42 annotation2196426 1 HindIII restriction site range2196426 1 1 6 annotation2196557 1 stop range2196557 1 43 48 BBa_K792001 1 MFa1-Kozak Kozak sequence from yeast α-factor mating pheromone (MFα1) 2012-09-23T11:00:00Z 2015-05-08T01:13:23Z http://www.yeastgenome.org/cgi-bin/locus.fpl?locus=MFA1 The Kozak sequence is the eukaryotic analog of the bacterial RBS, it is short sequence that includes the ATG, required for proficient initiation of translation. It is known that the 5???UTR sequence of the MFα1 gene of yeast produces efficient initiation of translation. This part is that specific region of the MFα1 gene. false false _1047_ 0 11811 9 Not in stock false None false Manuel Gim??nez annotation2197872 1 start range2197872 1 19 21 annotation2197870 1 BamHI restriction site range2197870 1 1 6 annotation2197871 1 rbs range2197871 1 7 21 BBa_K792002 1 MFa1-Secre Secretion tag from yeast α-factor mating pheromone (MFα1) 2012-09-23T11:00:00Z 2015-05-08T01:13:23Z Prepro-a-factorHas a Cleavable Signal Sequence [Water et al 1987] This part is the secretion signal peptide for the yeast α-mating factor. This signal peptide directs the secretion of the produced protein, and therefore allows for the exportation of it. This peptides are cleaved once the protein is in the lumen of the ER. false false _1047_ 0 11811 9 Not in stock false None false Manuel Gim??nez annotation2197873 1 secretion tag range2197873 1 1 54 BBa_K792005_sequence 1 aagcttcacaaccataatcacaaccacaatcataaccacaattaataa BBa_K792003_sequence 1 aagctttatggtagaaaaaagcgtagacaacgtagaaga BBa_K792009_sequence 1 ggatccacgattaaaagaatgagattcccatccattttcaccgctgttttgttcgccgcttcttctgctttggctaagctttatggtagaaaaaagcgtagacaacgtagaagaaagcttcacaaccataatcacaaccacaatcataaccacaattaataa BBa_K792002_sequence 1 agattcccatccattttcaccgctgttttgttcgccgcttcttctgctttggct BBa_K792001_sequence 1 ggatccacgattaaaagaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z