BBa_K808025 1 BBa_K808025 FsC: Cutinase PET cleaving enzyme 2012-09-01T11:00:00Z 2015-05-08T01:13:26Z Cloned from vector pEST100 from Becker et all 2005: (Becker, S., Theile, S., Heppeler, N., Michalczyk, A., Wentzel, A., Wilhelm, S., Jaeger, K.-E., et al. (2005). A generic system for the Escherichia coli cell-surface display of lipolytic enzymes. FEBS letters, 579(5), 1177???82. doi:10.1016/j.febslet.2004.12.087) Released HQ 2013 A cutinase is a cuticula degrading hydrolase from the fungus Fusarium solani pisi. It shows activity towards PET. false false _1065_ 0 11792 9 In stock false Surface Expression is very hard to do. FsC shows lipolytic activity and attacks the outer membrane of gramm negativ bacteria. This activity leads to a certain toxicity for expression hosts. In addition FsC needs to be expressed in the periplasm due to folding issues. false Marie Burghard, Henrik Cordes, Jascha Diemer, Adrian Eilingsfeld, Sven Jager, Rene Sahm, Arne Wehling BBa_K808025_sequence 1 atgctgcctacttctaaccctgctcaggagcttgaggcgcgccagcttggtagaacaactcgcgacgatctgatcaacggcaatagcgcttcctgcgccgatgtcatcttcatttatgcccggggttcaacagagacgggcaacttgggaactctcggtcctagcattgcctccaaccttgagtccgccttcggcaaggacggtgtctggattcagggcgttggcggtgcctaccgagccactcttggagacaatgctctccctcgcggtacctctagcgccgcaatcagggagatgcttggtctcttccagcaggccaacaccaagtgccctgacgcgactttgatcgccggtggctacagccagggtgctgcacttgcggccgcctccatcgaggacctcgactcggccattcgtgacaagatcgccggaactgttctgttcggctacaccaagaacctacagaaccgtggccgaatccccaactaccctgccgacaggaccaaggtcttctgcaatacaggagatctcgtttgtactggtagcttgatcgttgctgcacctcacttggcttatggtcctgatgctcggggccctgcccctgagttcctcatcgagaaggttcgggctgtccgtggttctgcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z