BBa_K808028 1 BBa_K808028 PhoA: signal sequence for peri plasmic expression 2012-09-01T11:00:00Z 2015-05-08T01:13:26Z Our phoA BioBrick is derived from the pEST100 vector which was used in the following publication: Becker, S., Theile, S., Heppeler, N., Michalczyk, A., Wentzel, A., Wilhelm, S., Jaeger, K.-E., et al. (2005). A generic system for the Escherichia coli cell-surface display of lipolytic enzymes. FEBS letters, 579(5), 1177???82. doi:10.1016/j.febslet.2004.12.087 PhoA is an N-terminal signal sequence for expression into the peri plasma. It derives from the native phosphatase A of E.coli and is similar to pelB. We used it to express our fusion protein (BBa_K808030) false false _1065_ 0 11792 9 In stock false As an signal peptide, our phoA has no stop codons and needs to be fused at the N-Terminus. false Marie Burghard, Jascha Diemer, Adrian Eilingsfeld, Philipp Rottmann, Rene Sahm, Arne Wehling BBa_K808028_sequence 1 atgaaacaaagcactattgcactggcactcttaccgttactgtttacccctgtgacaaaagcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z