BBa_K812053 1 BBa_K812053 RBS B0034 with GoldenBrick sequence 2012-09-19T11:00:00Z 2015-05-08T01:13:27Z This part has been amplified from B0034 with GoldenBrick extension This part is the GoldenBricked version of B0034 RBS. The sequence is the same but the biobrick sequence have been modified to enable GoldenBrick assembly, adding a BsaI site and the possibility of BbsI digestion of the scar once formed. To learn more about the GoldenBrick assembly our team have invented this year, go to: http://2012.igem.org/Team:Evry/GB false false _1069_ 0 8998 9 It's complicated false This part has been amplified from B0034 with GoldenBrick extension by PCR and cloned in pSB1C3 using EcoRI and PstI false Cyrille Pauthenier annotation2201457 1 XbaI range2201457 1 11 16 annotation2201450 1 GoldenBricked RBS B0034 range2201450 1 18 29 annotation2201453 1 EcoRI range2201453 1 1 6 annotation2201454 1 BsalI range2201454 1 7 12 annotation2201460 1 BsaI range2201460 1 37 42 annotation2201464 1 Spacer range2201464 1 30 30 annotation2201465 1 OH3 range2201465 1 32 35 annotation2201449 1 GoldenBrick RBS Prefix range2201449 1 1 17 annotation2201462 1 PstI range2201462 1 43 47 annotation2201459 1 SpeI range2201459 1 31 36 annotation2201463 1 OH2 range2201463 1 14 17 annotation2201451 1 Goldenbrick RBS Sufix range2201451 1 30 47 BBa_K812053_sequence 1 gaattcggtctctagacaaagaggagaaatactagtgagaccctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z