BBa_K812055 1 BBa_K812055 Terminator B0015 with GoldenBrick extension 2012-09-19T11:00:00Z 2015-05-08T01:13:27Z The part B0015 has been amplified by PCR with the new GoldenBrick extension, and then cloned in pSB1C3 using EcoRI and PstI. B0015 terminator with GoldenBrick extension This part is the GoldenBricked version of R0010 pLac promoter. The sequence is the same but the biobrick sequence have been modified to enable GoldenBrick assembly, adding a BsaI site and the possibility of BbsI digestion of the scar once formed. To learn more about the GoldenBrick assembly our team have invented this year, go to: http://2012.igem.org/Team:Evry/GB false false _1069_ 0 8998 9 It's complicated false This part has been created from B0015 by PCR amplification false Cyrille Pauthenier annotation2201984 1 EcoRI range2201984 1 1 6 annotation2201839 1 GoldenBrick Terminator prefix range2201839 1 1 17 annotation2202112 1 BsaI range2202112 1 159 164 annotation2202099 1 BsaI range2202099 1 7 12 annotation2202110 1 SpeI range2202110 1 148 153 annotation2202102 1 XbaI range2202102 1 11 16 annotation2202106 1 GoldenBrick Terminator suffix range2202106 1 147 169 annotation2202113 1 PstI range2202113 1 165 169 annotation2202111 1 OH5 range2202111 1 154 157 annotation2202105 1 BBa_B0012 range2202105 1 106 146 annotation2202103 1 BBa_B0010 range2202103 1 18 97 annotation2202101 1 OH4 range2202101 1 14 17 BBa_K812055_sequence 1 gaattcggtctctagacccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagtagcgggagaccctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z