BBa_K819006 1 BBa_K819006 Testing device for Luminesensor 2012-09-01T11:00:00Z 2015-05-08T01:13:29Z GFP with ssrA tag was from fromer Peking iGEM team members. a fast degrading GFP ligated to the rear of a sulA promoter in 408 form (only recognizable by our LexA-VVD fusing protein, not by E.coli endogenous LexA). The sulA promoter promotes a gene which express SulA protein, a differentiation inhibitor, and was a member of the SOS regulon family. When co-transformed with our luminesensor plasmid into E.coli cell illuminated by blue light, the light will triger the dimerizaiton of the LexA408-VVD fusion protein and the dimerized LexA408 domain will bind the SOS box in 408 form in the SulA408 promoter to inhibit the transcription of the downstream gene so that no GFP will be expressed; if the environment is dark, the luminesensor will not dimerize and no supression of the promoter will occour, and GFP will be expressed. false false _1077_ 0 13785 9 It's complicated true GFP ligated to the rear of a sulA promoter in 408 form (only recognizable by our LexA-VVD fusing protein, not by E.coli endogenous LexA). false YU Zhou annotation2197256 1 SulA408 Promoter range2197256 1 1 66 annotation2197257 1 RBS-GFP-ssrA:BBa_K581007 range2197257 1 70 846 BBa_K819006_sequence 1 cgaggctctttccgaaaatagggttgatctttgttgtcactggatgtaccgtacatccatacggtactaattaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatgcatgaactatacaaagctgctaacgacgaaaactacgctctggctgcttactagtag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z