BBa_K823034 1 BBa_K823034 3x FLAG tag (Freiburg standard+RBS) 2012-09-06T11:00:00Z 2015-05-08T01:13:30Z synthesis by gene art. 3x Flag tag with RBS in Freiburg standard. prefix: suffix: false false _1081_ 0 6378 9 In stock false For N- and C-terminal in-frame translational fusion to other genes in Freiburg standard. false Jara Radeck annotation2182331 1 FLAG range2182331 1 1 21 annotation2182332 1 FLAG range2182332 1 22 42 annotation2182333 1 FLAG range2182333 1 43 66 BBa_K823034_sequence 1 gattataaggatcatgatggtgattataaggatcatgatatcgactacaaagacgatgacgacaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z