BBa_K823036 1 BBa_K823036 cMyc-tag (Freiburg standard+RBS) 2012-09-06T11:00:00Z 2015-05-08T01:13:30Z Gene synthesis by gene art. cMyc-tag with RBS in Freiburg standard. prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT This is a part created by the LMU-Munich 2012 team. See here for other usefull parts of the [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks <p><i>Bacillus</p>B</i>io<p>B</p>rick<p>B</p>ox]. false false _1081_ 0 6378 9 In stock false We designed this part in Freiburg standard for inframe fusions. false Jara Radeck annotation2182255 1 misc range2182255 1 1 30 BBa_K823036_sequence 1 gaacaaaaacttattagcgaagaagatctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z