BBa_K823037 1 BBa_K823037 10x His-tag (Freiburg standard+RBS) 2012-09-07T11:00:00Z 2015-05-08T01:13:30Z Gene synthesis by GeneArt. 10xHis-tag with RBS in [[Help:Assembly_standard_25|Freiburg standard]]. prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions: [[Part:BBa_K823034|3x Flag tag]] [[Part:BBa_K823035|HA-tag]] [[Part:BBa_K823036|cMyc-tag]] [[Part:BBa_K823037|His-tag]] [[Part:BBa_K823038|Streptavidin-tag]] Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks '''''BacillusB'''''io'''B'''rick'''B'''ox]. false false _1081_ 0 11555 9 In stock false We designed the part in the Freiburg standard for N-and C-terminal fusions. false Jara Radeck annotation2182324 1 His range2182324 1 7 9 annotation2182329 1 His range2182329 1 22 24 annotation2182327 1 His range2182327 1 16 18 annotation2182330 1 His range2182330 1 25 27 annotation2182328 1 His range2182328 1 19 21 annotation2182325 1 His range2182325 1 10 12 annotation2182326 1 His range2182326 1 13 15 annotation2182322 1 His range2182322 1 1 3 annotation2182323 1 His range2182323 1 4 6 BBa_K823037_sequence 1 catcatcatcatcatcatcatcatcatcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z