BBa_K831001 1 BBa_K831001 HipB antitoxin from Escherichia coli K12 2012-09-25T11:00:00Z 2015-05-08T01:13:32Z This part was extracted of the genome of Escherichia coli K12 MG1655 using high fidelity PCR HipB is the antitoxin of the HipAB toxin-antitoxin (TA) module. HipB neutralizes the toxin effect of HipA due to protein-protein interactions. false false _1090_ 0 9809 9 It's complicated true No false Silvia J Ca??as annotation2199138 1 HipB range2199138 1 1 267 BBa_K831001_sequence 1 atgatgagctttcagaagatctatagcccaacgcaattggcgaatgcaatgaaactggttcgccagcaaaatggctggacgcagagcgagctggcgaaaaaaattggtattaagcaggcgacgatttccaatttcgaaaacaaccctgacaataccacgctcacgacattttttaagattttacagtcgcttgaactctcaatgacgctatgcgacgcgaaaaatgcctcgccagaatcaacagaacagcaaaatctggagtggtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z