BBa_K844002 1 BBa_K844002 Spider Silk 1x Subunit "W" (native sequence) 2012-10-01T11:00:00Z 2015-05-08T01:13:33Z Based on native 2E sequence from Brooks, et al. (2008) and DNA was artificially synthesized Spider silk 2E subunit native sequence; contains two elasticity domains and one strength domain. false false _1104_ 0 13908 9 In stock false none false Federico Carlos Rodriguez annotation2212196 1 Beta-helix range2212196 1 1 9 annotation2212207 1 Linker Domain range2212207 1 169 185 annotation2212201 1 Beta-helix range2212201 1 85 94 annotation2212200 1 Beta-spiral range2212200 1 69 84 annotation2212203 1 Beta-spiral range2212203 1 95 110 annotation2212204 1 Beta-spiral range2212204 1 114 129 annotation2212198 1 Beta-spiral range2212198 1 31 45 annotation2212202 1 Elasticity Domain range2212202 1 85 168 annotation2212195 1 Elasticity Domain range2212195 1 1 84 annotation2212206 1 Beta-spiral range2212206 1 153 168 annotation2212208 1 Strength Domain range2212208 1 186 204 annotation2212197 1 Beta-spiral range2212197 1 10 24 annotation2212199 1 Beta-spiral range2212199 1 46 60 annotation2212205 1 Beta-spiral range2212205 1 130 144 BBa_K844002_sequence 1 ggcggttatggtccgggcgccggccagcaaggtccgggcagccagggtccgggcagcggtggccaacagggtccgggtggtcagggcggttatggtccgggcgccggccagcaaggtccgggcagccagggtccgggcagcggtggccaacagggtccgggtggtcaggggccgtatggtccgagcgctgcggcagcggctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z