BBa_K851006 1 BBa_K851006 CzrA/ArsR new version (2) 2012-09-24T11:00:00Z 2015-05-08T01:13:34Z ===REFERENCES=== [1] http://partsregistry.org/Part:BBa_K174015<br> [2] http://2009.igem.org/Team:Newcastle<br> [3]http://2009.igem.org/Team:Newcastle/Metalsensing <br> [4] http://partsregistry.org/Part:BBa_K174016<br> [5] http://partsregistry.org/Part:BBa_K174017<br> [6] http://2012.igem.org/Team:UNAM_Genomics_Mexico<br> [7] http://2012.igem.org/Team:UNAM_Genomics_Mexico/Project/Description <br> [8] Dubey GP, Ben-Yehuda S. (2011) Intercellular nanotubes mediate bacterial communication. Cell.;144(4) :590-600<br> [9] http://partsregistry.org/Part:BBa_K851006<br> [10] Sato, T., and Kobayashi, Y. (1998) The ars operon in the skin element of Bacillus subtilis confers resistance to arsenate and arsenite. J Bacteriol 180: 1655???1661. <br> [11] Moore CM, Gaballa A, Hui M, Ye RW, Helmann JD (2005). Genetic and physiological responses of Bacillus subtilis to metal ion stress. Mol Microbiol(1) , 27???40. <br> [12] Busenlehner LS, Pennella MA, Giedroc DP (2003). The SmtB/ArsR family of metalloregulatory transcriptional repressors: Structural insights into prokaryotic metal resistance. FEMS Microbiol Rev , 27:131-143. <br> [13] Charles M Moore and John D Helmann(2005). Metal ion homeostasis in Bacillus subtilis. Current Opinion in Microbiology, 8:188???195. <br> CzrA/ArsR(2) is a combination of two different metal sensor systems already present in Bacillus Subtilis. It was made with the combined ArsR binding site and CadA promoter. <br> It is a variation of Biobrick Part:BBa_K174015[1] first proposed by Newcastle 2009 iGEM team [2] for the construction of a cadmium sensor[3] and also designed in with the combination of ArsR binding site (Part:BBa_K174016)[4] and cadA promoter (Part:BBa_K174017)[5]. We make some combinations for the localization of ArsR binding site within the CadA promoter in order to improve the repression by both transcription factors, in this case, the ArsR binding site is downstream the transcription start site next to the binding site of CzrA with the objective of block the transcription. <br> For iGEM UNAM Genomics M??xico 2012 project [6], CzrA/ArsR(1) was used in the design of an AND logic gate[7] using a recently described new type of communication system between Bacillus Subtilis cells called Nanotubes[8]. We synthetized three alternative forms of this part: which can be found here and in (PART CzrA/ArsR-Newcastle 2009)[1]and PART CzrA/ArsR-1(UNAM_Genomics 2012)[ 9]. <br> BIOLOGY In B. subtilis, ArsR has been shown to de-repress arsenical stress response genes of the ars operon in response to As(III) and Sb(III) [10](Sato and Kobayashi, 1998). It also has been shown to respond to Cd(II) and Ag(I) stress[11]. <br> ArsR/SmtB family metalloregulators negatively regulate genes involved with metal efflux [12]. Binding of inducers to one of (at least) two distinct metal binding sites triggers de-repression. ArsR negatively regulates itself, a gene of unknown function (yqcK) and genes encoding an As(III) efflux pump (arsB) and an As(V) reductase (arsC) [10,13]. <br> CzrA (formerly YozA in Bacillus subtilis), an ArsR homolog, represses two metal efflux systems [11] which are induced in response to several metals (Zn(II), Cd(II), Co(II) and Ni(II) and weakly to Cu(II))[13]. Specifically, CzrA represses the CadA efflux ATPase and the cation diffusion facilitator CzcD. CzrA has the unusual ability to respond to both thiophilic metals and Zn(II), Co(II) and Ni(II). <br> false false _1111_ 0 12295 9 It's complicated true ArsR binding site is downstream the transcription start site next to the binding site of CzrA with the objective of block the transcription false Abiel Trevi??o Garza annotation2196542 1 ArzR binding site range2196542 1 153 171 annotation2196539 1 -35 range2196539 1 18 24 annotation2196540 1 -10 range2196540 1 42 48 annotation2196541 1 CzrA binding site range2196541 1 56 87 BBa_K851006_sequence 1 ggcgcttgctgtttttcattgacactttcttggaaaacaacatataataggtgtaacttatatatgagtatatgctcatatatataaaataaatacaatactcattgatacgctttgaagagggaaccctaaatcggaaggtaagagtaatcaaaataaattgatttattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z