BBa_K861060 1 PfadR PfadR, synthetic promoter with tandem FadR binding site 2012-09-07T11:00:00Z 2015-05-08T01:13:35Z Escherichia coli str. K-12 substr. MG1655 At least to our knowledge, there is no promoter exists in nature that can respond solely to FadR since those promoters are often regulated by glucose concentration or oxidative stress and many other factors. We decided to design an artificial promoter to fulfill this task. Specifically, a tandem FadR binding site in FadL promoter is place downstream of promoter J23110 with 3 base pair overlap. We test its function in M9 medium with oleic acid as sole carbon source in plasmid pSB6A1. false false _1121_ 0 12357 9 In stock true None false Kuanwei Sheng annotation2183423 1 FadR tandem binding site range2183423 1 33 76 BBa_K861060_sequence 1 tttacggctagctcagtcctaggtacaatgctagctggtccgacctatactctcgccactggtctgatttctaaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z