BBa_K863102 1 CBDcex(T7) Cellulose binding Domain of C. Fimi Exoglucanase with T7, RBS, GS-Linker (Freiburg-Standard) 2012-09-18T11:00:00Z 2015-06-17T01:19:09Z Cloning-vector Cellulose binding domain of the [http://www.ncbi.nlm.nih.gov/nucleotide/327179207?report=genbank&log$=nucltop&blast_rank=3&RID=152ZCN0E01N Cellulomonas fimi ATCC 484 exoglucanase gene] in Freiburg-standard with T7, RBS, GS-Linker (Freiburg-Standard) false false _1123_ 4206 13080 9 Not in stock false You can find additional info to the Cellulose binding domain here: [http://partsregistry.org/Part:BBa_K863101:Design CBDcex_Freiburg] false Moritz M??ller annotation2187505 1 B0034 range2187505 1 21 32 annotation2187513 1 AgeI range2187513 1 365 370 annotation2187504 1 BBa_K525998 range2187504 1 1 32 annotation2187509 1 BBa_K863101 range2187509 1 38 373 annotation2187503 1 T7 promoter range2187503 1 1 20 annotation2187508 1 Exoglucanase range2187508 1 38 49 annotation2187512 1 GS-Linker range2187512 1 359 364 annotation2187514 1 TAA range2187514 1 371 373 annotation2187506 1 RBS range2187506 1 24 27 annotation2187510 1 Cellulose binding domain (CBDcex) range2187510 1 50 349 annotation2187507 1 ATG range2187507 1 35 37 annotation2187511 1 Exoglucanase range2187511 1 350 358 BBa_K863102_sequence 1 taatacgactcactatagggaaagaggagaaataatgggtccggccgggtgccaggtgctgtggggcgtcaaccagtggaacaccggcttcaccgcgaacgtcaccgtgaagaacacgtcctccgctccggtagacggctggacgctcacgttcagcttcccgtccggccagcaggtcacccaggcgtggagctcgacggtcacgcagtccggctcggccgtgacggtccgcaacgccccgtggaacggctcgatcccggcgggcggcaccgcgcagttcggcttcaacggctcgcacacgggcaccaacgccgcgccgacggcgttctcgctcaacggcacgccctgcacggtcggcggcagcaccggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z