BBa_K863206 1 BBa_K863206 Mating factor alpha 1 with Kozak sequence 2012-09-22T11:00:00Z 2015-05-08T01:13:37Z The Kozak sequence is based on the BioBrick BBa_J63003, but the sequence is used without the last bases atggag. And the MFalpha1 sequence is from the plasmid pPICZalpha A from Invitrogen. Released HQ 2013 long description is coming soon false false _1123_ 0 13076 9 In stock false design considerations are coming soon false Julia Schirmacher BBa_K863206_sequence 1 cccgccgccaccatgagatttccttcaatttttactgctgttttattcgcagcatcctccgcattagctgctccagtcaacactacaacagaagatgaaacggcacaaattccggctgaagctgtcatcggttactcagatttagaaggggatttcgatgttgctgttttgccattttccaacagcacaaataacgggttattgtttataaatactactattgccagcattgctgctaaagaagaaggggtatctctcgagaaaagagaggctgaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z