BBa_K864601 1 BBa_K864601 Lambda t1 transcriptional terminator 2012-09-24T11:00:00Z 2015-05-08T01:13:37Z Gene synthesis The lambda t1 is a strong transcriptional terminator with 99% efficiency in vivo. false false _1124_ 0 9827 9 In stock false - false Erik Lundin annotation2197328 1 lambda t1 terminator range2197328 1 1 53 BBa_K864601_sequence 1 ctgtaacagagcattagcgcaaggtgatttttgtcttcttgcgctaatttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z