BBa_K911003 1 BBa_K911003 Fluoride Sensitive Riboswitch 2012-09-11T11:00:00Z 2015-05-08T01:13:45Z Bacillus Cereus Genome Released HQ 2013 Riboswitch that is highly sensitive to the F- ion. We have characterized this part in three different chassis: TOP10 e.coli, Laboratory strain bacillus subtilis and a strain of bacillus subtilis with its normal fluoride riboswitch knocked out (kindly provided by the Breaker lab in Yale). Results of Miller assays for these three chassis are shown below. false false _1176_ 0 12694 9 In stock true Because this is a positive regulator (it ceases transcriptional termination in the presence of F- ions), it was decided that it should be placed upstream of a direct reporter, in this case lacZ as our reporter. false Oliver Meacock annotation2182732 1 Lysine promoter range2182732 1 1 43 annotation2182733 1 Fluoride riboswitch range2182733 1 61 139 BBa_K911003_sequence 1 aaaaataatgttgtccttttaaataagatctgataaaatgtgaactaaatgtaataattataggcgatggagttcgccataaacgctgcttagctaatgactcctaccagtatcactactggtaggagtctatttttttgagcaagctatttaaagagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z