BBa_K914003 1 BBa_K914003 L-rhamnose-inducible promoter (pRha) 2012-09-19T11:00:00Z 2015-05-08T01:13:45Z Amplification of the plasmid pJOE3075 (Dr. Altenbuchner). Released HQ 2013 L-rhamnose-inducible promoter is capable of high-level recombinant protein expression in the presence of L-rhamnose, it is also tightly regulated in the absence of L-rhamnose by the addition of D-glucose. false false _1179_ 0 13487 9 In stock true One base pair modified (90: A -> T) to avoid EcoRI site. Mutation made in a less conserved base pair. false Denis Samuylov annotation2188559 1 pRha range2188559 1 1 122 BBa_K914003_sequence 1 ccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgtattcaggcgctttttagactggtcgtaatgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z