BBa_K918000 1 BBa_K918000 Mating Factor Alpha Secretion Tag 2012-09-22T11:00:00Z 2015-05-08T01:13:46Z Saccharomyces cerevisiae genome The mating factor alpha secretion tag marks proteins for secretion. It is cleaved in the golgi before the desired protein is exported from the cell. Attach directly to the 5' end of your protein's sequence. false false _1183_ 0 13743 9 It's complicated true The sequence was taken from NCBI databases. We successfully synthesized it through Gibson Assembly and extracted it from yeast genomic DNA by PCR. false steven denham BBa_K918000_sequence 1 aaaagaatgagatttccttcaatttttactgcagttttattcgcagcatcctccgcattagctgctccagtcaacactacaacagaagatgaaacggcacaaattccggctgaagctgtcatcggttacttagatttagaaggggatttcgatgttgctgttttgccattttccaacagcacaaataacgggttattgtttataaatactactattgccagcattgctgctaaagaagaaggggtatctttggataaaagagaggctgaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z