BBa_K942001 1 BBa_K942001 scFv anti-His 2012-09-25T11:00:00Z 2015-05-08T01:13:48Z As a fusion protein, the DNA of this scFv was synthetized artificially, its parts comes from a murine antibody. This part is a single chain variable fragment (scFv), this is a fusion of the variable domains of antibodies. The antigen this scFv binds to with a greater stability is a C-terminal 6xHis tag; nevertheless it binds to tags with as less as 3xHis. It is formed by two domains, the variable heavy chain domain (VH) and the variable light chain domain (VL). About safety The part itself does not present any biohazard characteristic, but it is important to remember that it is designed to work in Pichia pastoris and that a biosecurity chamber is recommended to handle this organism, false true _1209_ 0 13053 9 It's complicated false This part is codon-optimized to be expressed in yeast. It is composed by two domains fused by a (GGGS)4 linker. false Luis Mario Leal Garza BBa_K942001_sequence 1 gacattttgatgacacaaaccccaagttctttgccagtctctttaggtgaccaagctagtatctcttgtagatcttcacaatctatcgttcattcaaacggtaacacttatttggaatggtacttacaaaaaccaggtcaatcacctaagttgttgatctataaggtatccaacagattttctggtgtcccagatagattctcaggttccggtagtggtactgactttacattgaagatctcaagagttgaagcagaagatttgggtgtatattactgtttccaaggtagtcacgttccttttaccttcggttctggtactaaattggaaattaagagaggtggtggtggtagcggtggtggtggttctggtggtggtggttcaggtggtggtggttcccaagttcaattacaacaatctggtccagaagacgtcaaacctggtgcctctgttaaaatatcatgcaaggcttccggttacacctttactgattactacatgaactgggtaaagcaatcacctggtaaaggtttggaatggattggtgacataaatcctaataacggtggtacttcctataaccaaaaattcaagggtagagcaacattaaccgtagataaatccagttctacagcctacatggaattgagatccttaaccagtgaagactcatccgtctattactgcgaatctcaatcaggtgcttattggggtcaaggtactacagttacagtatcagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z