BBa_M0052 1 BBa_M0052 AANDENYADAS (moderately fast) SsrA degradation tag. 2007-12-05T12:00:00Z 2015-05-08T01:13:51Z This variation of the SsrA tag was studied by McGinness, Baker, Sauer. 2006. Mol. Cell. 22:701. SsrA tags are prevalent in E. coli. This sequence codes for the amino acid sequence AANDENYADAS, a slower variation of the WT SsrA tag sequence, which, when fused to the C-terminal of proteins, will make the protein susceptible to moderately fast degradation through SspB-mediated binding to the ClpX protease. The following rates of degradation of this tag are pulled from the corresponding references below: ~1 Vmax/ [Clpx6] min-1 from (1). See the following references for further information on degradation rates and mechanisms of this tag: (1)McGinness, Baker, Sauer. 2006. Mol. Cell. 22:701. (2)Flynn et al 2003. Mol. Cell. 11: 671. Flynn et al. 2001. PNAS 98(19): 10584. Anderson et al 1998. App. Env. Microbiol. 64(6):2240. false false _11_ 0 2398 11 Not in stock false C-terminal tag. Degradation rate is moderately fast. Variations of this sequence yield different degradation rates(see Parts BBa_M0050, BBa_M0051, BBa_M0053). Sequence derived from reverse translation of AANDENYADAS sequence using codon usage optimized for E. coli. Three C-terminal aa's (DAS in this case) are necessary and sufficient for ClpX binding and degradation. Upstream aa sequence serves as a binding site for SspB, which guides rapid binding to ClpX. See sources on the main part page for further information about the mechanism of the system. NOTE: this sequence has only the amino acid sequence for the tag and bears NO STOP CODONS, so be sure to include them if you use this sequence. false Felix Moser annotation1958882 1 AANDENYADAS SsrA degradation tag range1958882 1 1 33 BBa_M0052_sequence 1 gctgctaacgacgaaaactacgctgacgcttct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z