BBa_M0100 1 BBa_M0100 tRNA_Arg5 to use as transcriptional reporter 2005-03-25T12:00:00Z 2015-05-08T01:13:51Z Released HQ 2013 tRNA_Arg5 to use as transcriptional reporter. Sequence is natural tRNA_Arg5 except with A to U mutation near its 3' end. false false _11_1_ 0 61 7 In stock false true jcbraff BBa_M0100_sequence 1 gatctgcattgtcctcttagttaaatggatataacgagcccctcctaagggctaattgcaggttcgattcctgcaggggactcca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z