BBa_M1000 1 BBa_M1000 Left mosaic end for Tn5 transpososome 2006-03-16T12:00:00Z 2015-05-08T01:13:51Z Synthesis from overlapping oligos Left end of a linear transpososome sequence containing the 19 bp mosaic end in the forward orientation. The sequence also contains a PvuII cut site which releases the transpososome when cut with PvuII. Constructed compound parts intended for transposition must not contain other PvuII end, or be PCR amplified with blunt end producing enzymes (Pfu, Phusion) at the PvuII cut site between CAG and CTG. This part, and the companion part M1001 provide Biobrick tools to construct Tn5 transpososomes: linear DNA sequences which can be cut in vitro from a plasmid backbone, or created by PCR, combined in vitro with purified Tn5 trasposase protein, electroportated into cells, and finally randomly inserting into the bacterial chromosome. The parts assembled between the two mosaic ends can be delivered, including antibiotic resistance markers or other functional chromosomal insertions. true false _41_48_1_ 0 6 48 Discontinued false ;biobrick left end, TA cloning overhang GTT TCT TCG AAT TCG CGG CCG CTT CTA GAG ;biobrick right end, TA cloning overhang GTT TCT TCC TGC AGC GGC CGC TAC TAG TA ;mosaic end with cag upstream to insert PvuII cut site cagCTGTCTCTTATACACATCT ;mosaic end reverse complement with ctg upstream to insert PvuII cut site AGATGTGTATAAGAGACAGctg ;mosaic left end in biobrick form construction primer F GTT TCT TCG AAT TCG CGG CCG CTT CTA GAG cagCTGTCTCTTATACACATCT, MEL-F ;mosaic left end in biobrick form construction primer R GTT TCT TCC TGC AGC GGC CGC TAC TAG TA AGATGTGTATAAGAGACAGctg, MEL-R ;mosaic right end in biobrick form construction primer F GTT TCT TCG AAT TCG CGG CCG CTT CTA GAG AGATGTGTATAAGAGACAGctg, MER-F ;mosaic right end in biobrick form construction primer R GTT TCT TCC TGC AGC GGC CGC TAC TAG TA cagCTGTCTCTTATACACATCT, MER-R true Tom Knight annotation1825568 1 PvuII cut site range1825568 1 1 6 annotation1825569 1 Mosaic End (forward) range1825569 1 4 22 BBa_M1000_sequence 1 cagctgtctcttatacacatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z