BBa_M10034 1 BBa_M10034 {&#706;Ag43_short!}, for Ag 43 autotransporter display system, only transporter 2009-05-09T11:00:00Z 2015-05-08T01:13:51Z The source of this part can be found from Escherichia coli str. K-12 substr. MG1655, complete genome. This part is in BglBricks Standard. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BglBricks Standard is available at This part is an actual transporter portion of an antigen 43 autotransporter display system based on this reference: PMID: 12107137. false false _271_ 0 4738 271 Not in stock true Bglbricking of M10034, Ag43 (autotransporter only) PCR Oso001 and Oso002 on E. coli MG1655 genomic DNA (937 bp, EcoRI/BamHI) Sub into pBca9495KC-Bca1144#5 (EcoRI/BamHI, L) Product is pBca9495KC-M10034 {<Ag43_short!} ---------------------------- Oso001 Cloning of Ag43, short ccataGAATTCatgAGATCTggtgaaaacaacagcgtccg Oso002 Cloning of Ag43 GCttaggatcctcagaaggtcacattcagtg false Sadao Ota BBa_M10034_sequence 1 ggttctggtccgacccagtctcactacggtcagtgcggtggtatcggttactctggtccgaccgtttgcgcttctggtaccacctgccaggttctgaacccgtactactctcagtgcctgggttctggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z