BBa_M10045 1 BBa_M10045 Myc Tag 2009-05-09T11:00:00Z 2015-05-08T01:13:51Z This part has already been constructed as a BglBricks basic part in plasmid pBca1256. Myc tag is a polypeptide derived from the c-myc gene product. It is useful in affinity chromatography to separate recombinant protein from wild type proteins in a host organism. Myc tag can also be used in various assays requiring recognition with an antibody. false false _271_ 0 4744 271 It's complicated false This part is a BglBricks (BBb). false Sam Ng BBa_M10045_sequence 1 gaacaaaaactcatctcagaagaggatctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z