BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_M1617 1 BBa_M1617 loXf+tetP+RBS+cre+ssRa+stop+loXr 2013-04-22T11:00:00Z 2015-05-08T01:13:57Z needs to be modified by Justin loXf: BBa_J61046 tetP promoter reverse: BBa_R0040 RBS: BBa_B0030 cre: BBa_J61047 ssRa: BBa_K313002 stop: BBa_B0015 loXr: BBa_J61046 false false _768_ 0 16140 9 Not in stock false Standard 10 compatible. false Justin Hyer component2216608 1 BBa_B0015 component2216601 1 BBa_M0051 component2216591 1 BBa_R0040 component2216590 1 BBa_J61046 component2216609 1 BBa_J61046 component2216597 1 BBa_B0030 component2216599 1 BBa_J61047 annotation2216601 1 BBa_M0051 range2216601 1 1171 1209 annotation2216599 1 BBa_J61047 range2216599 1 126 1162 annotation2216597 1 BBa_B0030 range2216597 1 105 119 annotation2216608 1 BBa_B0015 range2216608 1 1218 1346 annotation2216591 1 BBa_R0040 range2216591 1 43 96 annotation2216609 1 BBa_J61046 range2216609 1 1355 1388 annotation2216590 1 BBa_J61046 range2216590 1 1 34 BBa_M0051 1 BBa_M0051 AANDENYNYADAS. (Fast) SsrA degradation tag. 2007-12-05T12:00:00Z 2015-05-08T01:13:51Z This variation of the SsrA tag was studied by McGinness, Baker, Sauer. 2006. Mol. Cell. 22:701. This sequence codes for the amino acid sequence AANDENYNYADAS, a variation of the WT SsrA tag sequence, which, when fused to the C-terminal of proteins, will make the protein susceptible to fast degradation through SspB-mediated binding to the ClpX protease. The following rates of degradation of this tag are pulled from the corresponding references below: ~2 Vmax/ [Clpx6] min-1 from (1). See the following references for further information on degradation rates and mechanisms of this tag: (1)McGinness, Baker, Sauer. 2006. Mol. Cell. 22:701. (2)Flynn et al 2003. Mol. Cell. 11: 671. Flynn et al. 2001. PNAS 98(19): 10584. Anderson et al 1998. App. Env. Microbiol. 64(6):2240. false false _11_ 0 2398 11 Not in stock false C-terminal tag. Degradation rate is fast. Variations of this sequence yield different degradation rates(see Parts BBa_M0050, BBa_M0052, BBa_M0053). Sequence derived from reverse translation of AANDENYNYADAS sequence using codon usage optimized for E. coli. Three C-terminal aa's (DAS in this case) are necessary and sufficient for ClpX binding and degradation. Upstream aa sequence serves as a binding site for SspB, which guides rapid binding to ClpX. See sources on the main part page for further information about the mechanism of the system. NOTE: this sequence has only the amino acid sequence for the tag and bears NO STOP CODONS, so be sure to inlclude them if you use this sequence. false Felix Moser annotation1958881 1 AANDENYNYADAS SsrA deg. tag range1958881 1 1 39 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_J61046 1 lox [Lox] site for recombination 2007-02-20T12:00:00Z 2015-08-31T02:03:00Z bob Released HQ 2013 bob false false _95_ 0 483 95 In stock false bob true John Anderson BBa_J61047 1 Cre Cre DNA recombinase 2007-02-20T12:00:00Z 2015-08-31T02:03:00Z bob bob false false _95_ 0 483 95 In stock false bob true John Anderson BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_J61046_sequence 1 ataacttcgtataatgtatgctatacgaagttat BBa_M1617_sequence 1 ataacttcgtataatgtatgctatacgaagttattactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagattaaagaggagaaatactagatgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaacctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattaagaatttactagaggctgctaacgacgaaaactacaactacgctgacgcttcttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagataacttcgtataatgtatgctatacgaagttat BBa_B0030_sequence 1 attaaagaggagaaa BBa_M0051_sequence 1 gctgctaacgacgaaaactacaactacgctgacgcttct BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J61047_sequence 1 atgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaacctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattaagaatt BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z