BBa_M1670 1 BBa_M1670 group c project 2013-04-13T11:00:00Z 2015-05-08T01:13:57Z composite composite false false _768_ 0 16145 9 Not in stock false composite false siyuan wang component2214995 1 BBa_I712074 component2214996 1 BBa_J61100 component2215005 1 BBa_B0012 component2215000 1 BBa_K844000 component2215004 1 BBa_M1652 annotation2215000 1 BBa_K844000 range2215000 1 75 110 annotation2215004 1 BBa_M1652 range2215004 1 117 416 annotation2214996 1 BBa_J61100 range2214996 1 55 66 annotation2215005 1 BBa_B0012 range2215005 1 425 465 annotation2214995 1 BBa_I712074 range2214995 1 1 46 BBa_M1652 1 BBa_M1652 CXC chemokine BRAK mRNA 2013-03-25T12:00:00Z 2015-05-08T01:13:57Z Human source Anti-marker protein false false _768_ 0 16132 9 Not in stock false None known currently false Howard Cordingley annotation2214558 1 stop range2214558 1 298 300 annotation2214559 1 CXC range2214559 1 4 297 annotation2214557 1 start range2214557 1 1 3 BBa_J61100 1 BBa_J61100 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false true _95_ 0 483 95 In stock false N/A true John Anderson BBa_I712074 1 BBa_I712074 T7 promoter (strong promoter from T7 bacteriophage) 2007-10-21T11:00:00Z 2015-08-31T04:07:46Z T7 bacteriophage T7 promoter is very specific promoter which is transcribed only by specific T7 RNA polymerase. Usually this promoter is used in expression systems where T7 promoter is cotransfected with T7 RNA polymerase. That ensures strong transcription of desired genes. false false _130_ 0 1856 9 In stock false true Rok Gaber BBa_K844000 1 BBa_K844000 10x-Histidine (10x-His) Tag with double stop codon (TAATAA) 2012-10-01T11:00:00Z 2015-05-08T01:13:33Z Constructed through oligonucleotide annealing Released HQ 2013 10x-Histidine tag with double stop codon TAATAA to allow for better extraction of tagged products and protein termination in a single part. false false _1104_ 0 9404 9 In stock true none false Kathleen Miller annotation2206609 1 Stop range2206609 1 34 36 annotation2206608 1 Stop range2206608 1 31 33 annotation2206607 1 10x-Histidine Tag range2206607 1 1 30 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_J61100_sequence 1 aaagaggggaca BBa_M1670_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgcatactagagaaagaggggacatactagagcatcatcaccatcaccaccatcatcaccattaataatactagatgcgtctgctggctgcggcactgttactgctgctgttggcgttgtataccgctcgcgttgatggcagtaaatgtaaatgttcacgcaaaggtccgaaaattcgctactctgatgtgaagaaactggaaatgaaaccgaaatatccgcactgtgaagaaaaaatggttatcatcaccacgaaaagcgttagccggtatcgcgggcaggaacactgcttgcatccgaaactccagtccaccaaacgctttatcaagtggtataatgcttggaatgaaaaaagacgcgtgtacgaggagtgatactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I712074_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgca BBa_K844000_sequence 1 catcatcaccatcaccaccatcatcaccattaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_M1652_sequence 1 atgcgtctgctggctgcggcactgttactgctgctgttggcgttgtataccgctcgcgttgatggcagtaaatgtaaatgttcacgcaaaggtccgaaaattcgctactctgatgtgaagaaactggaaatgaaaccgaaatatccgcactgtgaagaaaaaatggttatcatcaccacgaaaagcgttagccggtatcgcgggcaggaacactgcttgcatccgaaactccagtccaccaaacgctttatcaagtggtataatgcttggaatgaaaaaagacgcgtgtacgaggagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z