BBa_M1986 1 BBa_M1986 rpsT gene from Methylobacterium Chloromethanicum 2012-03-26T11:00:00Z 2015-05-08T01:13:58Z Methylobacterium Chloromethanicum. The sequence comes from the site http://www.ncbi.nlm.nih.gov/nuccore/218528082?from=359&to=625 The rpsT gene binds directly to the 16s rRNA and induces post translational inhibition of arginine and ornithine decarboxylase false false _768_ 0 12223 9 Not in stock false I copied and pasted the sequence from NCBI. false David Harris annotation2171189 1 Open reading frame range2171189 1 4 264 annotation2171187 1 Start codon range2171187 1 1 3 annotation2171188 1 Stop Codon range2171188 1 265 267 BBa_M1986_sequence 1 atggccaacaccgtgtcggccaagaagatgacccgcaagatcgccaagcgtacggcgatcaaccgctcgcgccgttcgcggatgcgtaccttcgtccgcaaggtcgaggaggcgattgcgtccggcgatcagggccaggccctcaccgccctccgcgccgccgagccggagatcatgcgcgctgcccagaacggcatcgttcacaagaacaatgcctcgcggaaggtttcccgcctggccgcccgcgtgaaggccatcgcggcctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z