BBa_M300060 1 BBa_M300060 gene 9 2007-02-28T12:00:00Z 2015-05-08T01:13:59Z seeothers seeothers false false _102_ 0 1384 102 Not in stock false seeothers false Jennifer Chao annotation1917810 1 gene 9 range1917810 1 1 99 BBa_M300060_sequence 1 atgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgtttaatggaaacttcctcatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z