BBa_M31272 1 BBa_M31272 Redesigned M13K07 Gene VII Upstream 2007-02-27T12:00:00Z 2015-05-08T01:14:00Z M13K07 Redesign of the regulatory region upstream of Gene VII false false _102_ 0 1388 102 Not in stock false None false Robert Warden annotation1917194 1 Gene VII RBS range1917194 1 35 50 BBa_M31272_sequence 1 gttcggttcccttatgattgaccgtctgcgcctcgttccggctaagtaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z