BBa_M31520 1 BBa_M31520 g8 modified to be independent of g3 promoter 2007-02-27T12:00:00Z 2015-05-08T01:14:00Z atgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattTacTtcCaaGgcGagTtgaGAATTC This is a modified g8 that has point mutations to delete the promoter of g3 inside it. It also has an EcoRI restriction site added to the end. Therefore, it operates independent of g3. false false _102_ 0 1377 102 Not in stock false All point mutations made were checked to make sure they really are silent mutations that will not change the amino acid sequence of p8. false Han Zhu annotation1915213 1 g8 (modified) range1915213 1 7 228 annotation1919692 1 BglII range1919692 1 1 6 annotation1915215 1 EcoRI range1915215 1 229 234 BBa_M31520_sequence 1 agatctatgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaatttacttccaaggcgagttgagaattc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z