BBa_M31980 1 BBa_M31980 gene 7 from M13K07 modified 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z M13K07 genome gene 7 from M13K07 modified to remove rbs 9 and promoter of gene 8. false false _102_ 0 1373 102 Not in stock false n/a false Tiffany Guo BBa_M31980_sequence 1 atggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatctccgtagtactgtgtttcgcgctgggcattatcgctgggggccaaagatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z