BBa_M36037 1 BBa_M36037 Alpha Factor Mating Pheromone Producer 2011-12-10T12:00:00Z 2015-05-08T01:14:02Z This sequence originated from the coding for the thirteen amino acids for the pheromone in yeast. This gene encodes the thirteen amino acids that make up the Alpha factor yeast mating pheromone. In high enough concentrations it can lead to apoptosis in a-mating factor yeast and in low concentrations it induces mating. It is codon optimized for e coli. false false _848_ 0 11098 9 Not in stock false The gene has been optimized for e coli. false Joe Schlicht, Trevor! Kalkus, and David Eduardo Arrambide Montemayor BBa_M36037_sequence 1 tggcattggctgcagctgaaaccgggtcagccgatgtat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z