BBa_M36039 1 BBa_M36039 Bilirubin Sensor/Actuator Hybrid 2015-10-21T11:00:00Z 2015-12-02T08:12:55Z NCBI Gene Bank contained the sequence of the protein originally found in Anguilla japonica. In order to measure the bilirubin content in urine, we will design an actuator that that communicates the presence of bilirubin. Our product, a biological actuator, is the protein encoded by UnaG that will be continually transcribed and translated within the E.coli cells and then exported from them so that it can interact with any bilirubin present. An important distinction is that the gene is not activated by the presence of bilirubin???the protein will be produced regardless of the concentration of bilirubin. The UnaG protein will only be detectable, by measuring its fluorescence, when it interacts chemically with the bilirubin molecule. false false _848_ 29104 29104 9 false We need a secretion tag that would export our protein outside of the outer-most cell membrane such that it could interact with bilirubin in solution without the bilirubin being imported into the cell. false Sayuri Sekimitsu, Nate Hansen, Zoe Pacalin BBa_M36039_sequence 1 atggtagaaaaatttgtgggtacctggaagattgccgactcacacaactttggtgaatatttgaaagctattggggccccaaaggaactgtccgacggtggcgatgcgacaactccgacgctgtacatctcacagaaggatggcgataaaatgactgtgaagatcgaaaacggtccgcctacgttcctggatacgcaggttaaatttaagctcggcgaggaattcgatgaatttccgtctgaccgtcgcaaaggcgttaaaagcgtggtcaacctggtcggtgaaaaactggtatatgttcagaagtgggacggtaaagaaacgacatatgtgcgtgagatcaaagatggtaagttagttgtcaccttaaccatgggggacgtagtggccgtccgttcttatcgtcgtgccaccgaatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z